Groupes clonaux et propagation de la résistance au triméthoprime-sulfaméthoxazole dans Escherichia coli uropathogène

Groupes clonaux et propagation de la résistance au triméthoprime-sulfaméthoxazole dans Escherichia coli uropathogène

Contexte La résistance aux antibiotiques complique de plus en plus la prise en charge des infections urinaires Nous avons étudié dans quelle mesure un groupe d’Escherichia coli appelé groupe A cloné CGA, associé à la résistance au triméthoprime-sulfaméthoxazole TMP-SMZ, représentait une résistance au TMP-SMZ parmi Une série d’isolats d’E. coli uropathogènes et rectaux provenant d’une population universitaire de MichiganMethods Des isolats d’E. coli résistants et sensibles et des isolats E coli rectaux sélectionnés au hasard ont été évalués pour le statut CGA en utilisant les définitions de ce groupe – la séquence consensus intergénique répétitive entérobactérienne. Nous avons comparé les profils de gènes de virulence et les mécanismes moléculaires de résistance à TMP-SMZ entre des isolats classés CGA par les deux approches afin de mieux caractériser la relation entre isolats. des isolats qui présentaient le profil ERIC-PCR A, la moitié étaient résistants à TMP-SMZ et contenaient le SNP CT Les isolats du pattern A étaient divers, présentant de multiples mécanismes de résistance à TMP-SMZ et diverses combinaisons de facteurs de virulence CT Les isolats de SNP présentaient moins de variation, avec des résistances à TMP-SMZ et un intégron de classe I portant le gène dfrA présent dans les isolats résistants. Douze des souches présentaient la même combinaison de gènes de virulence. Les profils d’électrophorèse sur gel à champ pulsé étaient uniquesConclusion CGA , tel que défini par le SNP CT du fumC, semble être clonal lointain mais n’est pas un groupe lié à une éclosion Le groupe répandu a probablement évolué par transfert latéral de gènes conférant la virulence et la résistance aux antibiotiques

Infections des voies urinaires Les infections urinaires affectent ~ millions de personnes aux États-Unis chaque année et représentent ~% de toutes les prescriptions d’antibiotiques rédigées à cause des infections acquises dans la communauté Depuis, l’antibiotique de première intention recommandé pour le traitement été la triméthoprime-sulfaméthoxazole TMP-SMZ Cependant, la prévalence de la résistance au TMP-SMZ parmi les souches communautaires d’Escherichia coli, qui causent la majorité des infections urinaires , est passée de% au début de États , avec les niveaux de résistance les plus élevés dans l’Ouest et le Pacifique Nord-Ouest Au Michigan, une augmentation de la résistance de% à% a été observée au cours de la même période Pour ralentir et, idéalement, inverser la tendance les mécanismes responsables de la propagation de la résistance sont nécessaires Les techniques de typage des souches moléculaires fournissent un outil puissant pour comprendre le mécanisme de propagation des organismes pharmacorésistants. Par exemple, un groupe de dru Les isolats cliniques résistants au g qui ont acquis une résistance par des mutations de novo indépendantes ou par le transfert latéral d’un élément génétique conférant une résistance aux médicaments pourraient présenter un éventail diversifié de types de souches uniques. Par contre, les isolats résultant de la prolifération d’un clone pharmacorésistant Types de souches identiques ou très similaires Ces distinctions ne peuvent être faites que si la technique différencie de manière fiable les organismes apparentés et non apparentés avec un niveau significatif de discrimination, étant donné le taux d’évolution de l’organisme et le temps pendant lequel les organismes sont comparés endométriose. al a décrit un groupe d’isolats de E. coli résistants au TMP-SMZ disproportionnés, appelés «clones de groupe A», qui génèrent des profils de bandes similaires par la méthode de typage entérique inter-génique répétitive. de plusieurs populations différentes à travers les États-Unis , et il a été fr a suggéré que la propagation de CGA pourrait contribuer à augmenter les niveaux de résistance au TMP-SMZ Pour déterminer précisément dans quelle mesure le CGA contribue à la résistance au TMP-SMZ, une mesure valide et fiable de CGA est essentielle. CGA par l’utilisation d’ERIC-PCR, une méthode de typage fortement conditionnelle qui a une variabilité inter-expérimentation non seulement de l’intensité mais aussi de la présence ou de l’absence de bandes individuelles dans une empreinte bactérienne L’identification d’un nouveau SNP polymorphisme mononucléotidique , un gène d’entretien qui est apparemment unique à CGA, fournit une alternative fiable et moins subjective Nous avons utilisé ERIC-PCR et l’analyse de séquence directe de la région du gène fumC contenant le SNP récemment identifié pour déterminer dans quelle mesure CGA est contribuant à la résistance à la TMP-SMZ dans les isolats d’E. coli provenant d’infections urinaires qui ont été recueillies dans une population universitaire du Michigan. De plus, nous avons comparé la virulence gen Profils e et mécanismes moléculaires de résistance au TMP-SMZ entre les isolats classés CGA par les deux approches afin de mieux caractériser la relation entre les isolats de ce groupe

Méthodes

Trois cent vingt-huit isolats d’E. coli ont été prélevés chez des femmes âgées de 1 à 2 ans et infectés par une infection urinaire. [Tous les isolats résistants à TMP-SMZ n = et un échantillon aléatoire d’isolats sensibles à la TMP- SMZ, appariés par année et site de collecte, ont été typés au moyen d’ERIC-PCR Les isolats résistants inclus de ceux qui avaient précédemment été identifiés comme CGA d’un échantillon du Michigan Des isolats de Rectal E coli ont été prélevés chez des femmes âgées d’années en gynécologie Un échantillon prélevé au hasard d’isolats rectaux a été inclus pour les tests de sensibilité et le typage ERIC-PCR. Huit pour cent des isolats E coli rectaux échantillonnés au hasard étaient résistants aux tests de susceptibilité TMP-SMZAntibiotic Les CMI de TMP-SMZ pour les isolats urinaires ont été déterminés par une méthode de dilution en bouillon de microtitration Dade MicroScan, comme décrit ailleurs Les CMI de TMP-SMZ pour les isolats rectaux ont été de Terminé par Etest AB Biodisk Les MIC ont été interprétées selon les directives de l’empreinte digitale NCCLSERIC-PCR Les empreintes génétiques des isolats témoins et des isolats des infections urinaires ont été obtenues par des techniques ERIC-PCR comme décrit précédemment , avec des amorces fournies par Amee Manges University de California, Berkeley, et suivant un protocole illustré en personne par le Dr Manges Un isolat UTI précédemment identifié comme CGA a servi de standard de comparaison sur chaque gelInterprétation des empreintes ERIC Les empreintes digitales ERIC-PCR ont été interprétées par inspection visuelle, comme précédemment les isolats précédemment identifiés comme CGA de notre échantillon ont été empreints par ERIC-PCR et épuisés sur un seul gel, en tant qu’examen préliminaire pour déterminer la quantité de variance dans les profils de bandes de gel qui devrait correspondre à la définition du modèle. les isolats ont été visuellement inspectés par des chercheurs indépendants et évalués en fonction de la norme CGA chaque gel, ainsi que par rapport à la variation au sein du groupe comme indiqué par les isolats de gel de référence CGA qui présentaient les bandes lumineuses de ~ et bp qui caractérisaient le motif A étaient considérés comme des CGA isolats classés comme CGA par les deux chercheurs. réexécuter sur un seul gel pour confirmation, avec le criblage du gène CIV standardVirulence Tous les isolats ont été préalablement criblés pour identifier les facteurs de virulence uropathogènes, ainsi que les gènes des capsules du groupe III, par hybridation dot blot Les gènes comprennent les groupes: adhésines type et S fimbriae, Dr famille d’adhésines, et P pili, sidérophores aérobactine, proteases protéine de la membrane externe T, toxines facteur nécrosant cytotoxique et hémolysine, et gélules groupe II et IIMécanismes de résistance aux antibiotiques Tous les isolats résistants aux TMP-SMZ qui présentaient l’ERIC- Modèle de PCR Une empreinte digitale ou la combinaison la plus commune de gènes de virulence a été testée pour la présence de l’un des gènes dfr connus c La région de l’intégron de classe I a été amplifiée avec l’ensemble d’amorces hep ‘-TCATGGCTTGTTATGACTGT et hep’ -GTAGGGCTTATTATGCACGC, et les intégrons de classe II ont été amplifiés avec l’ensemble d’amorces hep ‘-CGGGATCCCGGACGGCATGCACGATTTGTA-‘ et hep ‘-GATGCCATCGCAAGTACGAG Les deux réactions ont été cyclées en ° C pour s, ° C pour s, et ° C pour min ADN de dfrA a été utilisé comme contrôle positif pour les intégrons de classe I produits de PCR d’isolats positifs pour la classe Les intégrons ont été purifiés à l’aide d’un kit de purification Qiagen QIAquick PCR et séquencé à l’Université du Michigan Ann Arbor Les séquences d’ADN des intégrons de classe I isolés ont été comparées aux séquences connues des gènes dfr pour déterminer quelle cassette de gène dfr l’integron contenait des motifs PFGE PFGE pour des isolats résistants au TMP-SMZ qui partageaient un mécanisme de résistance commun: un intégron de classe I -kb de classe I portant le gène dfrA ont été générés avec la rare enzyme de coupe NotI, conformément aux méthodes décrites ailleurs Les motifs de baguage ont été classés sur la base des critères décrits par Tenover et al Les motifs ont été classés comme suit: différant par ⩽ bande, identiques; différences par – bandes, étroitement liées; différences par – bandes, éventuellement apparentées; et différant de & gt; détection de SNP Quarante-cinq isolats présentant le profil ERIC-PCR Une empreinte digitale a été analysée pour la présence d’un SNP dans le gène d’entretien. L’ADN de fumage a été obtenu à partir de lysat bouilli et la PCR a été amplifiée avec les amorces CGGATGAAGTACTGGCAGGACAG et CGAr CGTGCATCGCCGTTGGAAAG [ Le protocole de PCR était de ° C pour min, suivi de cycles de ° C pour s, ° C pour s, et ° C pour min, et un min final à ° C Les produits de PCR ont été isolés avec un kit de purification PCR Qiagen QIAquick et séquencé au centre de séquençage de l’ADN de l’Université du Michigan. Les résultats ont été alignés avec les séquences fumC publiées pour déterminer la présence du SNP.

Résultats

Les examinateurs ont échoué à s’entendre sur le profil Un statut pour les empreintes digitales qui ont été considérées comme trop ambigu pour être considéré comme modèle A Soixante-neuf isolats% ont exhibé un patron A par lecture en double-aveugle Après avoir réexécuté les produits ERIC-PCR pour chacun de ces isolats putatifs de motif A, on a confirmé que le% de ces isolats positifs par lecture en double aveugle présentait le motif A Au total,% des isolats examinés étaient classés comme motif A Tous isolats dans notre échantillon précédemment désigné comme CGA tombaient dans notre modèle Un groupe Seize% d’isolats avec le modèle ERIC-PCR Une empreinte digitale contenait le SNP CT fumC Dans des expériences répétées, nous étions incapables de déterminer le statut SNP pour isoler avec le modèle Une empreinte digitale, que nous avons conservativement classé comme négatif pour une analyse plus approfondie

Figure Vue largeTélécharger un groupe représentatif de séquence consensus intergénique entérobactérienne répétitive – empreintes PCR utilisées pour classer les infections des voies urinaires et le contrôle rectal Escherichia coli isolées comme motif A ou non A L’isolat E coli dans la voie est un étalon de référence précédemment identifié comme «motif». A « par Manges et al Isolates dans les voies et ont été classés comme modèle A par des lecteurs indépendants sur la base de la présence de bandes dominantes à ~ et bp Lane, -kb ladder; voie, contrôle négatifFigure View largeTélécharger un groupe représentatif d’entérobactéries séquence consensus intergénique répétitif – empreintes digitales RCR utilisées pour classer les infections des voies urinaires et contrôle rectal Escherichia coli isolées comme modèle A ou non A L’isolat E coli dans la voie est un étalon de référence précédemment identifié comme « pattern A » par Manges et al Isolates dans les voies et ont été classés comme modèle A par des lecteurs indépendants sur la base de la présence de bandes dominantes à ~ et bp Lane, -kb ladder; voie, contrôle négatif Le motif A était significativement associé à la résistance au TMP-SMZ, les isolats résistants étant plus susceptibles que les isolats sensibles de présenter un profil A% CI, -; de même, les isolats du groupe A qui étaient résistants au TMP-SMZ étaient plus susceptibles de contenir le SNP CT du fumC que les isolats du groupe A qui étaient sensibles au TMP-SMZ% CI, – tableau

Tableau View largeDownload slidePrévalence de la séquence consensus intergénique répétitive entérobactérienne ERIC-PCR modèle A et du SNP polymorphisme nucléotidique simple du fumC CT parmi les infections des voies urinaires UTI et isolats rectaux prélevés chez des femmes âgées de – au Service de santé de l’Université du Michigan, Ann Arbor, par résistance au triméthoprime-sulfaméthoxazoleTable View largeTélécharger la diapositivePrévalence de la séquence consensus intergénique répétitive entérobactérienne ERIC-PCR modèle A et du polymorphisme nucléotidique simple du fumC CT SNP parmi les infections urinaires et isolats rectaux recueillies auprès des femmes âgées de – au service de santé de l’Université du Michigan , Ann Arbor, par résistance à la triméthoprime-sulfaméthoxazoleEn utilisant une signature de virulence , nous avons examiné la présence ou l’absence de tous les gènes de la virulence plus les gènes et sous-types de la capsule pili. isole l’onglet La signature de virulence la plus commune était la présence de type pili fim, pili pff, aerobactin aer, capsule du groupe II kpsMT, ompT ompT, et papGAD, représentant% des isolats du motif A et pour% des isolats du motif A qui contenaient le SNP CT du fumC Cette signature de virulence prévalente PVS est survenue chez seulement% des isolats de type A non P =

Tableau View largeDownload slideFréquence des signatures de virulence dans le groupe d’infections des voies urinaires et des isolats rectaux d’Escherichia coli présentant la séquence consensus intergénique répétitive entérobactérienne Modèle ERIC-PCR A fingerprintTable View largeDownload slideFrequence des signatures de virulence dans le groupe d’infections urinaires et d’isolements rectaux Escherichia coli présentant la séquence consensus intergénique répétitive entérobactérienne ERIC-PCR modèle A empreinte

Tableau View largeDownload slideFréquence des signatures de virulence dans le groupe d’isolats présentant la séquence consensus intergénique répétitive entérobactérienne modèle ERIC-PCR Une empreinte digitale et le polymorphisme mononucléotidique CT dans le gène fumCTable View largeDownload slideFrequency des signatures de virulence dans le groupe d’isolats présentant l’entérobactérie séquence consensus intergénique répétitive modèle ERIC-PCR Une empreinte digitale et le polymorphisme mononucléotidique CT dans les isolats de gène FVC du gène fumC étaient plus susceptibles d’être résistants au TMP-SMZ que les isolats sans cette combinaison de gènes de virulence% CI, – Ils étaient également plus susceptible d’être un isolat de l’UTI par rapport à un isolat rectal OU; % IC, – Lorsque les isolats PVS ont été retirés de l’analyse, l’association entre le profil A et la résistance à TMP-SMZ était statistiquement non significative. % CI, – Les isolats qui étaient résistants à TMP-SMZ et présentaient soit le modèle A ERIC-PCR, PVS, les deux, ou le SNP varié en présence ou en l’absence d’intégrons de classe I et de classe II et dans la taille de ces tableaux d’intégrons Tous les isolats qui présentaient l’empreinte A du modèle ERIC-PCR et le PVS contenaient un intégron de classe I de kb, qui contenait le gène dfrA, et étaient résistants au TMP-SMZ Il y avait une forte association entre ces isolats et UTI, avec% des isolats provenant des infections urinaires et% des contrôles rectaux P = les isolats de ce groupe étaient responsables de% des infections urinaires dans notre échantillon Tous les isolats identifiés par le modèle ERIC-PCR Une empreinte digitale et le PVS, qui partageait un mécanisme commun de résistance induite par le gène dfrA, contenue dans un intégron -kb de classe I, était positive pour le SNP CT des isolats positifs pour le SNP qui ne présentaient pas le PVS, étaient résistants au TMP-SMZ et contenaient un intégron -kb de classe I portant le df gène rA, était résistant à TMP-SMZ et ne contenait pas d’intégrons de classe I, et était sensible à TMP-SMZ

Tableau View largeTélécharger les mécanismes génétiques de la résistance au triméthoprime-sulfaméthoxazole TMP-SMZ dans les isolats classés par entérobactérie séquence consensus intergénique répétitive ERIC-PCR modèle A, la signature de virulence prévalente PVS; , le schéma A et le PVS, et le SNP du polymorphisme nucléotidique simple du fumC CT parmi les isolats d’Escherichia coli résistants au TMP-SMZ qui présentaient soit l’empreinte A du modèle ERIC-PCR, soit le PVSTable Voir grandDownloadMécanismes génétiques de la résistance au triméthoprime-sulfaméthoxazole TMP-SMZ dans les isolats classés par séquence consensus intergénique répétitive entérobactérienne, modèle ERIC-PCR A, la signature de virulence prévalente PVS; , le profil A et le PVS, et le SNP du polymorphisme mononucléotidique du fumC CT parmi les isolats d’Escherichia coli résistants au TMP-SMZ qui présentaient l’empreinte A du modèle ERIC-PCR ou les profils de bandes PVSPFGE pour les isolats présentant le profil A de ERIC-PCR. et PVS étaient divers chiffre, avec chaque isolat présentant un motif de bande unique Trois isolats ont été classés comme des voies éventuellement liées, et, dans la figure, tandis que tous les autres isolats ont été classés comme différents selon les critères de Tenover et al

Figure Vue grandDownload slideNotI PFGE de l’infection des voies urinaires et des isolats de contrôle rectal qui présentait à la fois la séquence consensus intergenique répétitif entérobactérien -PCR modèle A et la signature de virulence prévalente et contenait le fumC CT polymorphisme mononucléotidique Lane, marqueur; voies -, isolats d’infection urinaire; PFGE de l’infection des voies urinaires et des isolats de contrôle rectal qui présentaient à la fois la séquence consensus intergénique répétitive entérobactérienne -PCR modèle A et la signature de virulence prévalente et contenait le polymorphisme mononucléotidique du fumC CT Lane, marqueur; voies -, isolats d’infection urinaire; voies et, isolats de contrôle rectal

Discussion

descriptions précédentes de CGA Cependant, la variation était plus grande lorsque le groupe a été défini par l’empreinte ERIC-PCR A que lorsqu’elle a été définie par le fumC CT SNPLes faiblesses techniques de la méthode de typage ERIC-PCR ont été largement rapportées [, Comme décrit par Manges et al , le modèle ERIC-PCR Une empreinte digitale est caractérisée par des bandes brillantes et légères, avec des variations de motifs de bandes en dehors de cette région Nous avons observé un grand degré de variation du profil de bande d’une référence CGA standard entre les expériences, avec les bandes brillantes constamment apparentes mais variant considérablement en intensité d’un cycle à l’autre et les bandes plus légères souvent non apparentes Malgré l’utilisation de plusieurs stratégies pour minimiser les erreurs de classification, la variabilité technique dans le modèle ERIC-PCR. présenté un obstacle considérable à la caractérisation précise du groupe CGAThe fumC CT SNP permet un dosage considérablement plus fiable, parce que le séquençage direct De plus, le SNP, une mutation ponctuelle partagée dans un gène métabolique essentiel, indique de vraies relations biologiques, car les isolats avec ce SNP représentent probablement un groupe lié à l’évolution. plus variables que prévu d’une épidémie, les isolats positifs pour le fumC CT SNP étaient hautement homogènes: presque tous étaient résistants au TMP-SMZ, et tous les isolats résistants avaient un intégron -kb de classe I portant le gène dfrA Un profil de gène de virulence unique prédominait, et chaque isolat qui présentait à la fois le profil ERIC-PCR A et le PVS était positif pour le SNP CT du fumC. Néanmoins, nous avons observé des profils PFGE uniques parmi les isolats qui avaient le SNP CT fumC, le PVS et l’intégron de classe I gène dfrA Bien que les profils PFGE de ces isolats étaient plus similaires que ce que l’on pouvait attendre d’un groupe d’organismes non apparentés, la rouge par & gt; bandes Selon les critères décrits par Tenover et al , les isolats différant par & gt; les bandes doivent être classées comme non apparentées dans le contexte d’une éclosion. La GCa ne correspond pas à la définition d’un clone épidémiologiquement apparenté dans le contexte d’une éclosion, mais semble être verticalement liée à un ancêtre commun éloigné. Un groupe issu d’un seul ancêtre commun partagent une «épine dorsale» génomique, reflétée par la similarité des gènes domestiques comme les fumées, mais peuvent varier considérablement en présence d’éléments génétiques échangés horizontalement, sur lesquels on trouve souvent des gènes de virulence et de résistance aux antibiotiques . aboutir à différents profils PFGE: l’insertion d’un élément dans le génome changerait la taille des bandes et, en fonction de l’addition ou de la perturbation des sites de reconnaissance des enzymes de restriction, le nombre de bandes dans le profil Ceci est cohérent avec la diversité des profils PFGE au sein du groupe CGA défini par le SNP dans notre échantillon d’étude, ainsi que dans les rapports précédents Unsurp de plus en plus, les chercheurs qui ont utilisé le PFGE pour isoler des isolats E. coli obtenus à Cook County Hospital à Chicago, Illinois, où le taux de résistance au TMP-SMZ était de%, n’ont trouvé aucune preuve d’association clonale entre isolats par PFGE. les approches qui capturent les relations dans le squelette génomique, telles que le typage de séquences multilocus, sont robustes à un tel échange horizontal et, par conséquent, peuvent être utilisées pour identifier les relations ancestrales dans un contexte de haut niveau d’échange horizontal. Le gène ménager fumCol est très analogue à l’approche de typage par séquences multilocus et, par conséquent, permet l’identification du groupe CGA, malgré divers antécédents d’échange horizontal dans ce groupe. Un certain nombre de rapports ont observé la prédominance d’un mécanisme unique de résistance à TMP-SMZ. -un intégron de classe I portant le gène dfrA-parmi les deux isolats résistants au TMP-SMZ identifiés comme appartenant à CGA et TMP-SMZ-resistan Les relations entre le groupe CGA ancestral et l’intégron de classe I portant le gène dfrA ne sont pas claires. L’homogénéité de la taille de l’intégron de classe I identifiée dans CGA isolats suggère la possibilité que cet élément ait été acquis par une seule souche qui a ensuite proliféré verticalement et divergé via un transfert horizontal conséquent. Cet intégron peut être largement disséminé dans une population diversifiée d’E. coli uropathogènes dans lesquels des souches CGA éloignées sont communes. est que les souches CGA sont plus sensibles à l’absorption de l’intégron que d’autres souches uropathogènes Pour clarifier cette relation, il serait nécessaire d’évaluer l’étendue de la distribution de l’intégron de classe I dfrA dans et au-delà du groupe CGA dans une population échantillon basé

Remerciements

Nous remercions Patricia Tallman, Joan DeBusscher et Amee Manges pour leur aide technique et leurs conseils. Soutien financier Bourse de l’Institut National de la Santé DK-Conflits d’intérêts potentiels Tous les auteurs: pas de conflits