Effet des antiviraux sur la réplication de l’herpèsvirus humain chez les receveurs de greffe de cellules souches hématopoïétiques

Effet des antiviraux sur la réplication de l’herpèsvirus humain chez les receveurs de greffe de cellules souches hématopoïétiques

Nous avons examiné notre expérience avec la maladie du SNC associée au HHV pour évaluer à la fois la présentation clinique et virologique et la réponse à la thérapie antivirale. Une recherche de notre virologie la base de données de janvier à juin a identifié des receveurs de HSCT qui avaient détecté l’ADN HHV par réaction de polymérase en chaîne dans le liquide céphalo-rachidien du LCR; Dysfonctionnement du SNC sans autre étiologie clairement identifiée Les taux de HHV dans le sérum et le LCR ont été évalués avant et après traitement par ganciclovir et / ou foscarnet Les valeurs médianes du HHV-CSF semblent diminuer avec le temps en même temps que le taux sérique de thérapie antivirale vs copies / ml [P =]; Niveau de liquide céphalorachidien versus copies / ml [P =], test de signe Nos données suggèrent que HHV- peut provoquer une maladie du SNC modérée à sévère après transplantation HSC Des études prospectives sont nécessaires pour définir le spectre de la maladie associée au HHV et déterminer si un traitement antiviral offre un bénéfice clinique

Environ% des adultes ont des anticorps anti-HHV- anti-herpès humain détectables dans le sérum et de l’ADN HHV dans la salive et les cellules mononucléaires du sang périphérique. L’infection primaire au HHV survient typiquement à l’âge de mois et, comme les autres herpesvirus semble rester latent dans le corps après l’infection primaire, sauf en période d’immunosuppression HHV- a été montré pour réactiver après greffe de cellules souches hématopoïétiques Cependant, à ce jour, il y avait peu d’informations concernant les implications de HHV- Réactivation dans les transplantations de cellules souches hématopoïétiques Récipiendaires de HSCT Un certain nombre de cas ont décrit une encéphalite associée à HHV- En outre, une étude cas-témoin comparant des receveurs de HSCT présentant une encéphalite avec un groupe de patients immunodéprimés sans encéphalite a trouvé l’ADN HHV dans CSF en% versus seulement% des patients, respectivement Ces résultats suggèrent que la présence de HHV- dans le LCR est associée au SNC Depuis la publication de ces rapports de cas, notre centre a augmenté la surveillance de HHV- parmi HSCT éprouvant un dysfonctionnement CNS Nous avons effectué cette revue descriptive des patients de notre institution qui ont HHV détecté dans le LCR pour mieux définir la maladie HHV dans Les receveurs de HSCT, pour évaluer la réponse virologique à la thérapie antivirale, et pour explorer les facteurs de risque possibles pour la maladie

Patients et méthodes

Identification des patients et collecte des données Une base de données informatisée contenant tous les résultats de la PCR de l’herpèsvirus pour les patients du Centre de recherche sur le cancer Fred Hutchinson, FHCRC; Seattle a été utilisé pour identifier les patients qui avaient HHV-ADN détecté dans un échantillon de CSF Tous les échantillons de CSF ont été obtenus par les médecins gestionnaires et ont été soumis à des fins cliniques La base de données a été recherchée de Janvier à Juin Onze individus avec HHV détectés dans un échantillon de LCR Les dossiers médicaux de tous les patients ont été examinés pour des informations démographiques et cliniques Les patients ont été divisés en catégories: «asymptomatiques», ou patients sans dysfonctionnement cliniquement apparent du SNC au moment de l’obtention du LCR pour le test HHV n =; «Autre étiologie», ou patients atteints d’un dysfonctionnement du SNC chez qui d’autres étiologies ont été identifiées pour expliquer leurs anomalies n =; et « HHV-encéphalite », ou des patients avec un dysfonctionnement du SNC chez qui aucune autre étiologie n’a été identifiée pour expliquer leurs anomalies n = Les données des patients atteints d’encéphalite HHV ont été stratifiées en fonction de ceux qui ont survécu et ceux qui sont décédés dans le mois du diagnostic. Des échantillons de sérum et de liquide céphalorachidien ont été examinés pour évaluer la charge virale au fil du temps par rapport à la thérapie antivirale. Cela impliquait la récupération du sérum et du liquide céphalorachidien conservés. échantillons, si possible, pour des tests HHV-HHV-ADN supplémentaires dans le sérum et le LCR juste avant le traitement antiviral ont été comparés avec les niveaux de HHV dans les échantillons de sérum et de LCR au, et semaines après le début du traitement antiviral. les patients devaient avoir ⩾ « pré-thérapie » et ⩾ « post-thérapie » échantillon du même fluide disponible Revue institutionnelle du HCR L’approbation du conseil d’administration a été obtenue pour ce projet. La recherche clinique a été menée conformément aux directives pour l’expérimentation humaine, telles que spécifiées par le comité d’examen institutionnel du FHCRCAnalyse statistique L’analyse statistique a été effectuée en utilisant la version SPSS; SPSS, version SAS; SAS Institute et Epi Info version; Les logiciels ont été comparés entre les groupes avec le test or ou le test exact de Fisher si les hypothèses requises pour le test were n’étaient pas satisfaites Les variables continues ont été comparées entre les groupes par des tests non paramétriques Les lignes de régression linéaire ont été ajustées au sérum et des niveaux de virus CSV HHV- obtenus au fil du temps chez chaque patient qui avait ⩾ échantillons du même type de PCR Lorsque le sérum et le LCR n’étaient pas disponibles pour le test, nous avons utilisé des résultats cliniques obtenus ailleurs Quand sérum et LCR des échantillons étaient disponibles, l’ADN a été extrait des échantillons comme décrit ailleurs , et l’ADN de l’herpèsvirus a été testé par PCR quantitative en temps réel. Les amorces et les sondes fluorescentes spécifiques du virus Epstein-Barr EBV et cytomégalovirus CMV [ ] l’ADN cible a été décrit ailleurs. Le virus de l’herpès simplex HSV a été détecté en utilisant l’ensemble d’amorces HSVgB, CCGTCAGCACCTTCAT HSVgB inverse CGA et CGCTGGACCTCCGTGTAGTC inverse HSVgB et la sonde HSVgB, CCACGAGATCAAGGACAGCGGCC HSVNEWgB sonde HHV- a été détectée en utilisant l’ensemble d’amorces R, GTTAGGATATACCGATGTGCTTGAT R [A] et TACAGATACGGAGGCAATAGATTTG R [B], et la sonde R, TCCGAAACAACTGTCTGACTGGCAAAA R [P] Varicella zoster virus VZV a été détecté en utilisant les amorces, TCCGTTCTGGGTTCTGGTTGA VZV et GCGCGGGGTCGCCTGATACTT VZV et la sonde, ACCACCCGGGCCCTGTGTTCG VZV Pour chaque analyse PCR effectuée pour la détection de l’herpèsvirus, un sérum -μL ou un échantillon de CSF a été testé. La discrimination entre les variants HHV-A et HHV-B a été accomplie par PCR réalisée à l’aide de Biosystems Perkin Elmer-Applied Detector Sequence tel que décrit ailleurs Ce test PCR amplifie une région hautement conservée% identique du gène U ​​dans HHV-A et HHV-B Les séquences d’amorces sont communes aux deux souches, tandis que les sondes ont été conçues dans une région avec une différence de -bp entre HHV-A et HHV-B L’amorce directe était ‘-TTCCGGTATATGACCTTCGTAAGC-‘ La sonde HHV-A était ‘-ACATTATATGTCGAACTTGACACTACCTTCCG-‘ UprobeA et était étiquetée à la ‘extrémité avec FAM et à la’ extrémité avec TAMRA La sonde HHV-B était ‘-CATTATATATCGAATCTGACGCTACCTTCCG – UprobeB et il a été marqué à la fin avec VIC et à la fin avec TAMRA Le test U est capable de distinguer le variant HHV-A du variant HHV-B, y compris plusieurs souches de laboratoire de HHV-A, par exemple, U , GS, et SIE et HHV-B Z, et des souches de type sauvage de HHV-B et des souches de type sauvage de HHV-A non représentées

Résultats

Nous avons identifié des individus qui, entre juillet et juin, avaient HHV détecté dans leur LCR après transplantation. Dans l’ensemble, les receveurs de HSCT avaient des échantillons cliniques de LCR soumis à un test HHV-PCR pendant cette période. ADN détecté Parmi les patients avec HHV- dans leur LCR, était asymptomatique, présenté avec des constatations pathologiques concomitantes, et avait HHV- comme seul agent pathogène définissable. Le patient patient asymptomatique solitaire; La table avait un échantillon de CSF qui a testé pour HHV- après que HHV-ADN a été trouvé dans son échantillon de sérum Elle n’a pas, cependant, eu des changements évidents de statut mental Les patients dans le groupe « autre étiologie » patients et ont présenté un dysfonctionnement du SNC transplantation; Les patients atteints d’encéphalite à VHZ présentaient un dysfonctionnement du système nerveux central, présenté au cours des jours suivant la transplantation, et n’avaient pas d’autres causes identifiées pour expliquer leurs symptômes et leurs symptômes neurologiques. une tentative pour exclure d’autres causes potentielles de dysfonctionnement du SNC chez les patients atteints d’encéphalite HHV, nous avons testé d’autres herpèsvirus en utilisant des échantillons de sérum disponibles des patients et des échantillons de LCR des patients. Nous n’avons pas pu détecter EBV, CMV, HSV et VZV dans les échantillons de sérum et de liquide céphalo-rachidien testés. Le diagnostic de l’encéphalite à HHV est apparu de plus en plus fréquemment au cours des derniers mois de l’étude. de ces patients ont reçu un diagnostic de HHV, alors que les autres ont eu un diagnostic de HHV au cours de la période de mai à juin

Tableau View largeTélécharger slideCaractéristiques des patients ayant eu un herpèsvirus humain – HHV – détecté dans leur LCR après transplantation de juillet à juillet Tableau View largeTélécharger slideCaractéristiques des patients ayant un herpèsvirus humain – HHV – détecté dans leur LCR après transplantation de juillet à juillet Niveaux d’ADN HHV- Les taux maximaux d’ADN HHV dans les sérums et les CSF sont apparus plus élevés chez les patients atteints d’encéphalite HHV que chez les patients du groupe «autre étiologie», bien que le tableau de signification statistique n’ait pas été atteint. Le patient asymptomatique avait un taux sérique maximal. CSF HHV- niveaux de et, copies / mL, respectivement

Tableau View largeTélécharger la lameMaximum herpesvirus humain HHV-ADN niveaux dans les échantillons de sérum et de CSF de ceux avec « HHV-encéphalite » et « autre étiologie » Tableau View largeTélécharger diapositiveHaximum herpesvirus humain HHV-ADN dans les échantillons de sérum et de LCR de ceux avec « HHV-encéphalite »Et« autre étiologie »Tous les patients ont reçu du ganciclovir n = et / ou du foscarnet n = comme traitement de leur infection par le HHV. Seuls les patients avaient déjà reçu du ganciclovir ou du foscarnet. Le patient avait reçu foscarnet pour le traitement de l’antigénémie Réactivation du HHV Foscarnet a été interrompu ~ semaines avant la détection du HHV-Median sérum journal HHV- niveaux de copies / mL gamme, – copies / mL avant la thérapie antivirale à copies / ml gamme, – copies / mL semaine après le traitement P =; test de signe De même, le log médian des niveaux de CSF de HHV- a diminué de copies / ml gamme, – copies / mL avant la thérapie antivirale à des copies / gamme mL, – copies / mL semaines après le traitement antiviral P =; test de signe Les courbes de régression étaient adaptées aux résultats du sérum HHV-sérum et du LCR pour les patients qui avaient un & gt; échantillon disponible pour l’évaluation chiffre Les taux sériques de HHV- ont diminué chez les patients, et les taux de HHV- du CSF ont diminué chez les patients pour lesquels les échantillons obtenus successivement ont été évalués Niveaux d’ADN HHV chez les patients atteints d’encéphalite HHV pour lesquels les taux de HHV dans les échantillons obtenus successivement Chez les patients atteints d’encéphalite à HHV, la charge virale HHV a semblé diminuer avec le temps, et l’état clinique a semblé s’améliorer, au moins temporairement, en même temps que l’utilisation du traitement antiviral. Pour les autres patients Les patients et la charge virale dans les échantillons de LCR et dans les échantillons de LCR et de sérum, respectivement, n’ont pas semblé changer au fil du temps. En raison de ce manque de changement, le foscarnet a été abandonné chez le patient. et le patient est mort Le niveau post-mortem CSF HHV- chez ce patient était & gt; La patiente asymptomatique était également évaluée pour la réponse au ganciclovir et au foscarnet. Son taux sérique diminuait avant l’instauration du traitement antiviral. Le taux de CSF était très élevé, les copies d’ADN / mL avant le début du traitement antiviral, et diminuaient. après l’initiation de foscarnet

Figure vue largeDownload lignes de régression linéaires adaptées pour enregistrer les niveaux de HHV- herpèsvirus humain à partir des échantillons de sérum haut et CSF bas au fil du temps par rapport au début du traitement antiviral avec le ganciclovir et / ou foscarnet Les lignes de régression individuelles sont référencées par « Pt, Pt, etc. » suivi du nombre total de points de données patient contribuant à chaque ligne de régression « n = x » Les niveaux HHV- de chaque patient sont référencés par leur numéro de patient Patients, et partagent une ligne parce qu’ils ont tous seulement des valeurs de * HHV- Les lignes de régression linéaires permettent d’enregistrer les niveaux de HHV de l’herpèsvirus humain à partir des échantillons de sérum supérieur et du fond du LCR au fil du temps par rapport au début du traitement antiviral par le ganciclovir et / ou le foscarnet. sont référencés par « Pt, Pt, etc, » suivi par le nombre total de points de données patient contribuant à chaque ligne de régression « n = x » Chaque patien Les niveaux de HHV du log de t sont référencés par leur numéro de patient Patients, et partagent une ligne parce qu’ils avaient tous seulement des valeurs de * HHV- dans des copies d’ADN / mL Les fonctions logarithmiques ont une base

Figure View largeTélécharger slide Herpèsvirus humain HHV- charge virale dans les échantillons de LCR et de sérum / mL au fil du temps chez les patients atteints d ‘«encéphalite à HHV» Les informations concernant le traitement antiviral figurent dans la légende inférieure de chaque panneau AV, antiviral; GCV, ganciclovir; FSCT, foscarnet Le dosage antiviral est exprimé en mg / kg / jour suivi du nombre de jours où la dose a été reçue après la transplantation, c.-à-d. «Mg / kg / jour» se réfère à une dose de mg / kg / jour transplantationFigure View largeTélécharger diapositiveHuman herpesvirus HHV- charge virale dans les échantillons de LCR et de sérum / mL au fil du temps chez les patients atteints d ‘«encéphalite à HHV» Les informations concernant la thérapie antivirale se trouvent dans la légende inférieure de chaque panneau AV, antiviral; GCV, ganciclovir; FSCT, foscarnet Le dosage antiviral est exprimé en mg / kg / jour suivi du nombre de jours où la dose a été reçue après la transplantation, c.-à-d. «Mg / kg / jour» se réfère à une dose de mg / kg / jour transplantationHHV-typing Des études de typage des isolats HHV-ADN récupérés chez des patients atteints d’encéphalite HHV et chez des patients dont le dysfonctionnement du SNC avait d’autres étiologies ont révélé HHV-B dans tous les cas sauf un. Chez ce patient patient, HHV-A a été retrouvé Comparaison des patients atteints d’encéphalite associée au HHV avec la population générale du FHCRC Les patients atteints d’encéphalite associée au HHV étaient plus susceptibles que la population générale du FHCRC d’avoir reçu des greffes de donneurs non apparentées apparentées ou non apparentées , des transplants de sang de cordon ombilical et une globuline antithymocyte ou BC, un anticorps monoclonal anti-CD P & lt; ; table

Table View largeTélécharger slideCaractéristiques du Centre de recherche sur le cancer Fred Hutchinson FHCRC transplantés de cellules souches hématopoïétiques atteints d’herpèsvirus humain – encéphalite à HHV de septembre à juin, comparé à tous les greffés de première greffe FHCRC de janvier à novembre Tableau View largeTélécharger les caractéristiques de Fred Hutchinson Cancer Research Centre FHCRC transplants de cellules souches hématopoïétiques avec herpesvirus-HHV- encéphalite humaine de Septembre à Juin, par rapport à tous les primo-transplantés FHCRC première fois de Janvier à Novembre encéphalite associée au HHV: ceux qui sont morts peu de temps après le diagnostic par rapport à ceux qui ont survécu. Les patients avec une encéphalite associée au HHV sont décédés dans le mois suivant la date du diagnostic. Les patients décédés semblaient plus susceptibles d’avoir des résultats anormaux sur un scanner IRM cérébral et des taux élevés de protéines dans le LCR que ceux qui avaient survécu. qui a survécu P =; tableau Le niveau médian d’ADN HHV-pic dans le liquide céphalorachidien était, copies / ml chez ceux qui sont morts par rapport à, copies / ml chez ceux qui ont survécu, mais ce n’était pas une différence statistiquement significative P =; tableau Il n’y avait pas non plus de différence significative entre les survivants et ceux qui sont décédés par rapport à l’âge; sexe; pourcentage qui a reçu ATG ou BC; ou pour cent qui ont reçu du sang de cordon ombilical allogénique, ou des données de transplantations non apparentées ou non apparentées non montrées

Tableau View largeTéléchargement de diapositives pour les receveurs de greffe de cellules souches hématopoïétiques avec réactivation de HHV-herpèsvirus du SNC qui ont survécu, comparé aux résultats pour ceux qui sont mortsTable View largeTéléchargement de diapositives chez des receveurs de greffe de cellules souches hématopoïétiques qui ont survécu ceux qui sont morts

Discussion

HHV-encéphalite a été diagnostiqué semblait plus probable que ceux qui ont survécu pour avoir des résultats anormaux d’études IRM et des niveaux élevés de protéines CSF Cela implique que HHV- peut avoir joué un rôle actif dans la morbidité et la mortalité par le biais de la CNS Cependant, le La patiente «asymptomatique» présentait un taux élevé d’ADN-HHV dans son échantillon de LCR, ce qui suggère que la relation entre la maladie du HHV et celle du SNC peut être compliquée par un certain nombre de facteursHHV- a été démontré dans la plupart des études in vitro pour répondre au ganciclovir et foscarnet Sept des individus pour lesquels la PCR des échantillons de LCR ou de sérum a été effectuée au moins au cours du temps ont présenté une diminution de la charge virale au fil du temps en même temps que la thérapie antivirale. Cependant, la réponse à la thérapie antivirale n’était pas universelle, et nos données ne fournissent aucune perspective quant à savoir si le foscarnet ou le gan En général, les taux de HHV-CSF semblaient supérieurs aux taux sériques, et la diminution des taux de CSF semblait être inférieure à celle des taux sériques. qui avaient détectable HHV- dans les échantillons de sérum a eu la résolution de leur virémie avant l’initiation de la thérapie antivirale, alors que le plus tôt un niveau de CSF a été documenté pour retourner aux copies / mL était dans la troisième semaine de thérapie HHV- dynamique virale ne sont pas bien compris, bien que il a été montré que la virémie, documentée soit par PCR de sérum ou de plasma, soit par culture de PBMC, a une durée de vie relativement courte dans les populations pédiatriques avec infection primaire bien que le virus puisse persister plus longtemps dans le Le typage HFV HHV-a révélé que les patients avaient des comptes de type B de virus de type B pour la plupart des infections primaires et des événements de réactivation chez les receveurs de HSCT Cependant, le virus HHV-A La sur-représentation dans les échantillons d’enfants du LCR, suggérant un potentiel de neurotropisme supérieur HHV-A et HHV-B ont des réponses similaires aux antiviraux dans les études in vitro Cependant, le patient avec le virus HHV-A identifié patients qui ont maintenu des taux élevés de HHV malgré un traitement par le foscarnet et le ganciclovir Il sera important d’évaluer les données cliniques pour déterminer la stratégie de traitement antiviral optimale pour HHV-A et HHV-BTIl n’y a pas eu de grandes études prospectives publiées à ce jour. facteurs déterminants de la maladie associée au HHV chez les receveurs de HSCT La détermination des facteurs de risque de la maladie associée au HHV aiderait à développer des protocoles de traitement prophylactiques ou préemptifs. Dans notre étude des facteurs de risque possibles de maladie associée au HHV, nous avons trouvé que Des transplantations non apparentées, des greffes de sang de cordon ombilical et une ATG ou une BC ont été associées à une encéphalite à HHV. Des greffes non apparentées et non apparentées ont été La transplantation de cellules souches hématopoïétiques peut être un facteur de risque de maladie à CMV Il est possible que la réception de greffes non apparentées ait un effet direct sur le développement de la réactivation du HHV et de la maladie par allo-activation de cellules latentes. Il est également possible que ces types de transplantations puissent être associés indirectement à la maladie HHV par GVHD et / ou à l’immunosuppression utilisée pour traiter la GVHD. Une association entre GVHD et la présence de HHV- dans la peau et le liquide BAL a été suggérée Cordon ombilical Les greffes de sang de cordon peuvent être plus longues à greffer que les autres types de transplantation. En outre, tous les greffés de sang de cordon de notre établissement reçoivent des ATG dans le cadre de leur régime de conditionnement, sauf si les patients ont eu des réactions d’hypersensibilité à la réception de ATG par des receveurs de greffe d’organes solides a été associée à une maladie due à CMV et EBV En outre, BC, un anticorps monoclonal anti-CD, a été associé à une réactivation du HHV chez les receveurs de HSCT La réception d’ATG ou d’autres produits similaires peut entraîner une augmentation de l’immunosuppression par élimination des lymphocytes. activation de l’HHV latent par l’activation des lymphocytes ciblés. De nombreuses questions demeurent sans réponse concernant l’épidémiologie et le traitement optimal de la maladie HHV chez les receveurs de HSCT. L’interprétation des données présentées dans ce manuscrit est limitée en raison de la nature rétrospective de l’étude et de la Cependant, ces données s’ajoutent à un corpus croissant de littérature suggérant que HHV- est un agent pathogène important chez les receveurs de HSCT. Des études prospectives pour définir ces problèmes sont justifiées. En outre, il semble que le ganciclovir et le foscarnet puissent avoir des antiviraux in vivo. Résultats Essais contrôlés pour évaluer si l’amélioration clinique est associée à la thérapie antivirale sont nécessaires